/usr/share/perl5/Bio/DB/SoapEUtilities/FetchAdaptor/seq.pm is in libbio-perl-run-perl 1.6.9-1.
This file is owned by root:root, with mode 0o644.
The actual contents of the file can be viewed below.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 | # $Id$
#
# BioPerl module for Bio::DB::SoapEUtilities::FetchAdaptor::seq
#
# Please direct questions and support issues to <bioperl-l@bioperl.org>
#
# Cared for by Mark A. Jensen <maj -at- fortinbras -dot- us>
#
# Copyright Mark A. Jensen
#
# You may distribute this module under the same terms as perl itself
# POD documentation - main docs before the code
=head1 NAME
Bio::DB::SoapEUtilities::FetchAdaptor::seq - Fetch adaptor for 'seq'
efetch SOAP messages
=head1 SYNOPSIS
Imported by L<Bio::DB::SoapEUtilities::FetchAdaptor> as required.
=head1 DESCRIPTION
Returns an iterator over L<Bio::Seq> or L<Bio::Seq::RichSeq> objects,
depending on the the return type of the C<efetch>. A standard
C<efetch> to a sequence database will return a GenBank SOAP result;
this will be parsed into rich sequence objects:
my $fac = Bio::DB::SoapEUtilities->new;
my $seqio = $fac->efetch(-db => 'protein', -id => 730439)->run(-auto_adapt=>1);
my $seq = $seqio->next_seq;
$seq->species->binomial; # returns 'Bacillus caldolyticus'
An C<efetch> with C<-rettype => 'fasta'> will be parsed into
L<Bio::Seq> objects (VERY much faster):
$seqio = $fac->efetch( -rettype => 'fasta' )->run(-auto_adapt=>1);
$seq = $seqio->next_seq;
$seq->species; # undef
$seq->desc; # kitchen sink
To find out the object type returned:
$class = $seqio->obj_class;
as for all L<Bio::DB::SoapEUtilities::FetchAdaptor> objects.
=head1 SEE ALSO
L<Bio::DB::SoapEUtilities>, L<Bio::DB::SoapEUtilities::FetchAdaptor>
=head1 FEEDBACK
=head2 Mailing Lists
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to
the Bioperl mailing list. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
=head2 Support
Please direct usage questions or support issues to the mailing list:
L<bioperl-l@bioperl.org>
rather than to the module maintainer directly. Many experienced and
reponsive experts will be able look at the problem and quickly
address it. Please include a thorough description of the problem
with code and data examples if at all possible.
=head2 Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track
of the bugs and their resolution. Bug reports can be submitted via
the web:
http://redmine.open-bio.org/projects/bioperl/
=head1 AUTHOR - Mark A. Jensen
Email maj -at- fortinbras -dot- us
=head1 CONTRIBUTORS
Much inspiration from L<Bio::SeqIO> and family.
=head1 APPENDIX
The rest of the documentation details each of the object methods.
Internal methods are usually preceded with a _
=cut
# Let the code begin...
package Bio::DB::SoapEUtilities::FetchAdaptor::seq;
use strict;
use Bio::Root::Root;
use Bio::Annotation::Collection;
use Bio::Annotation::Comment;
use Bio::Annotation::DBLink;
use Bio::Annotation::Reference;
use Bio::Annotation::SimpleValue;
use Bio::Factory::FTLocationFactory;
use Bio::SeqFeature::Generic;
use Bio::Seq::SeqBuilder;
use Bio::Seq::SeqFactory;
use Bio::Species;
use base qw(Bio::DB::SoapEUtilities::FetchAdaptor Bio::Root::Root);
our %VALID_ALPHABET = (
'AA' => 'protein',
'DNA' => 'dna',
'RNA' => 'rna'
);
our %TYPE_XLT = (
'Bio::Seq' => ['TSeqSet','TSeq'],
'Bio::Seq::RichSeq' => ['GBSet', 'GBSeq']
);
sub _initialize {
my ($self, @args) = @_;
$self->SUPER::_initialize(@args);
my ($builder, $seqfac ) = $self->_rearrange( [qw(SEQBUILDER
SEQFACTORY)], @args );
# choose rich or simple seq based on result
my ($t) = keys %{$self->result->som->method};
for ($t) {
/^GB/ && do {
$t = 'GB'; # genbank info
$self->{'_obj_class'} = ($seqfac ? $seqfac->type : 'Bio::Seq::RichSeq');
last;
};
/^T/ && do {
$t = 'T'; # fasta info
$self->{'_obj_class'} = ($seqfac ? $seqfac->type : 'Bio::Seq');
last;
};
$self->throw("FetchAdaptor::seq : unrecognized result elt type '$t', can't parse");
}
$self->{'_builder'} = $builder || Bio::Seq::SeqBuilder->new();
$self->{'_builder'}->sequence_factory(
$seqfac || Bio::Seq::SeqFactory->new( -type => $self->{'_obj_class'} )
);
$self->{'_locfac'} = Bio::Factory::FTLocationFactory->new();
$self->{'_idx'} = 1;
1;
}
sub rewind { shift->{'_idx'} = 1 }
sub obj_class { shift->{'_obj_class'} }
sub builder { shift->{'_builder'} };
sub locfac { shift->{'_locfac'} };
sub next_obj {
my $self = shift;
my $t = $TYPE_XLT{$$self{_obj_class}};
my $stem = "//$$t[0]/[".$self->{'_idx'}."]";
my $som = $self->result->som;
my $seqid;
return unless defined $som->valueof("$stem");
my $get = sub { $som->valueof("$stem/$$t[1]_".shift) };
# speed up (?) by caching top-level data hash
my $toplev = $som->valueof("$stem");
my $get_tl = sub { $toplev->{"$$t[1]_".shift} };
my %params = (-verbose => $self->verbose);
if ($t->[0] =~ /^T/) {
$params{'-display_id'} = $get_tl->('accver');
$params{'-primary_id'} = $get_tl->('gi');
$params{'-length'} = $get_tl->('length');
$params{'-desc'} = $get_tl->('defline');
$params{'-seq'} = $get_tl->('sequence');
$params{'-alphabet'} = $get_tl->('seqtype') || undef;
$self->builder->add_slot_value(%params);
($self->{_idx})++;
if ( !$self->builder->want_object ) { # skip
$self->builder->make_object;
goto &next_obj;
}
else {
return $self->builder->make_object;
}
}
elsif ($t->[0] =~ /^GB/) {
# source, id, alphabet
$params{'-display_id'} = $get_tl->('locus');
$params{'-length'} = $get_tl->('length');
$get_tl->('moltype') =~ /(AA|[DR]NA)/;
$params{'-alphabet'} = $VALID_ALPHABET{$1} || '';
# molecule, division, dates
$params{'-molecule'} = $get_tl->('moltype');
$params{'-is_circular'} = ($get_tl->('topology') eq 'circular');
$params{'-division'} = $get->('division');
$params{'-dates'} = [$get_tl->('create-date'), $get_tl->('update-date')];
$self->builder->add_slot_value(%params);
%params = ();
if ( !$self->builder->want_object ) { # skip this
$self->builder->make_object;
($self->{_idx})++;
goto &next_obj;
}
# accessions, version, pid, description
$get_tl->('accession-version') =~ /.*\.([0-9]+)$/;
$params{'-version'} = $params{'-seq_version'} = $1;
my @secondary_ids;
my @ids = $get->('other-seqids/GBSeqid');
foreach (@ids) {
/^gi\|([0-9]+)/ && do {
$seqid = $params{'-primary_id'} = $1;
$params{'-accession_number'} = $_; # correct?
next;
};
do { # else
push @secondary_ids, $_;
next;
};
}
$params{'-secondary_accessions'} = \@secondary_ids;
$params{'-desc'} = $get->('definition');
# sequence
if ( $self->builder->want_slot('seq')) {
$params{'-seq'} = $get->('sequence');
}
# keywords
if ($get->('keywords')) {
my @kw;
foreach my $kw ($som->valueof("$stem/GBSeq_keywords/*")) {
push @kw, $kw;
}
$params{'-keywords'} = join(' ',@kw);
}
$self->builder->add_slot_value(%params);
%params = ();
my $ann;
# annotations
if ($self->builder->want_slot('annotation')) {
$ann = Bio::Annotation::Collection->new();
# references
if ($get->('references')) {
$ann->add_Annotation('reference', $_)
for _read_references($stem,$som);
}
# comment
if ($get_tl->('comment')) {
$ann->add_Annotation('comment',
Bio::Annotation::Comment->new(
-tagname => 'comment',
-text => $get_tl->('comment')
)
);
}
# project
if ( $get_tl->('project') ) {
$ann->add_Annotation('project',
Bio::Annotation::SimpleValue->new(
-value => $get_tl->('project')
)
);
}
# contig
if ($get_tl->('contig')) {
$ann->add_Annotation('contig',
Bio::Annotation::SimpleValue->new(
-value => $get_tl->('contig')
)
);
}
# dblink
if ($get_tl->('source-db')) {
_read_db_source($ann, $get);
}
$self->builder->add_slot_value(-annotation => $ann);
}
# features
my $feats;
if ($self->builder->want_slot('features')) {
$feats = _read_features($stem,$som,$self->locfac,$get);
$self->builder->add_slot_value(
-features => $feats
);
}
# organism data
if ( $self->builder->want_slot('species') && $get_tl->('source') ) {
my $sp = _read_species($get);
if ($sp && !$sp->ncbi_taxid) {
my ($src) = grep { $_->primary_tag eq 'source' } @$feats;
if ($src) {
foreach my $val ($src->get_tag_values('db_xref')) {
$sp->ncbi_taxid(substr($val,6)) if index($val,"taxon:") == 0;
}
}
}
$self->builder->add_slot_value( -species => $sp );
}
}
else {
$self->throw("FetchAdaptor::seq : unrecognized result elt type '$t', can't parse");
}
($self->{_idx})++;
return $self->builder->make_object;
}
# mostly ripped from Bio::SeqIO::genbank...
sub _read_species {
my ($get) = @_;
my @unkn_names = ('other', 'unknown organism', 'not specified', 'not shown',
'Unspecified', 'Unknown', 'None', 'unclassified',
'unidentified organism', 'not supplied');
# dictionary of synonyms for taxid 32644
my @unkn_genus = ('unknown','unclassified','uncultured','unidentified');
# all above can be part of valid species name
my( $sub_species, $species, $genus, $sci_name, $common,
$abbr_name, $organelle);
$sci_name = $get->('organism') || return;
# parse out organelle, common name, abbreviated name if present;
# this should catch everything, but falls back to
# entire GBSeq_taxonomy element just in case
if ($get->('source') =~ m{^
(mitochondrion|chloroplast|plastid)?
\s*(.*?)
\s*(?: \( (.*?) \) )?\.?
$}xms ) {
($organelle, $abbr_name, $common) = ($1, $2, $3); # optional
} else {
$abbr_name = $get->('source'); # nothing caught; this is a backup!
}
# Convert data in classification lines into classification array.
my @class = split(/; /, $get->('taxonomy'));
# do we have a genus?
my $possible_genus = quotemeta($class[-1])
. ($class[-2] ? "|" . quotemeta($class[-2]) : '');
if ($sci_name =~ /^($possible_genus)/) {
$genus = $1;
($species) = $sci_name =~ /^$genus\s+(.+)/;
}
else {
$species = $sci_name;
}
# is this organism of rank species or is it lower?
# (we don't catch everything lower than species, but it doesn't matter -
# this is just so we abide by previous behaviour whilst not calling a
# species a subspecies)
if ($species && $species =~ /subsp\.|var\./) {
($species, $sub_species) = $species =~ /(.+)\s+((?:subsp\.|var\.).+)/;
}
# Don't make a species object if it's empty or "Unknown" or "None"
# return unless $genus and $genus !~ /^(Unknown|None)$/oi;
# Don't make a species object if it belongs to taxid 32644
my $src = $get->('source');
return unless ($species || $genus) and
!grep { $_ eq $src } @unkn_names;
# Bio::Species array needs array in Species -> Kingdom direction
push(@class, $sci_name);
@class = reverse @class;
my $make = Bio::Species->new();
$make->scientific_name($sci_name);
$make->classification(@class) if @class > 0;
$make->common_name( $common ) if $common;
$make->name('abbreviated', $abbr_name) if $abbr_name;
$make->organelle($organelle) if $organelle;
return $make;
}
sub next_seq { shift->next_obj }
sub _read_references {
my ($stem, $som) = @_;
my @ret;
for ( my $i = 1; $som->valueof($stem."/GBSeq_references/[$i]"); $i++ ) {
my $get = sub {
$som->valueof($stem."/GBSeq_references/[$i]/GBReference_".shift )
};
my %params;
$params{'-title'} = $get->('title');
$params{'-pubmed'} = $get->('pubmed');
$params{'-medline'} = $get->('pubmed');
$params{'-journal'} = $get->('journal');
$params{'-comment'} = $get->('remark');
$params{'-consortium'} = $get->('consortium');
my $pos = $get->('position');
$pos and $pos =~ /^([0-9]+)[.]+([0-9]+)$/;
$params{'-start'} = $1;
$params{'-end'} = $2;
$params{'-gb_reference'} = $get->('reference');
$params{'-authors'} = '';
foreach my $author ( $get->('authors/*') ) {
$params{'-authors'} .= " $author";
}
push @ret, Bio::Annotation::Reference->new(
-tagname => 'reference',
%params);
}
return @ret;
}
sub _read_features {
my ($stem, $som, $locfac, $get_pri) = @_;
my @ret;
my $seqid = $get_pri->('primary-accession');
for ( my $i = 1; $get_pri->("feature-table/[$i]"); $i++ ) {
my $get = sub {
$som->valueof($stem."/GBSeq_feature-table/[$i]/GBFeature_".shift )
};
my $loc;
my $sf = Bio::SeqFeature::Generic->direct_new();
if ($get->('location')) {
# may have to parse GBIntervals instead here...
$loc = $locfac->from_string( $get->('location') );
if ($seqid && !($loc->is_remote)) {
$loc->seq_id($seqid);
}
}
$sf->location($loc);
$sf->seq_id($seqid);
$sf->primary_tag($get->('key'));
$sf->source_tag('EMBL/GenBank/SwissProt');
# fill other fields using $sf->add_tag_value...
# qualifiers are name => value pairs. add as tags
# to this feature
if ($get->('quals')) {
foreach ($get->('quals/*')) {
$sf->add_tag_value( $_->{'GBQualifier_name'},
$_->{'GBQualifier_value'} );
}
}
if ($get->('partial5')) {
$sf->add_tag_value( 'is_partial5',
$get->('partial5') eq 'true' ? 1 : 0)
}
if ($get->('partial3')) {
$sf->add_tag_value( 'is_partial3',
$get->('partial3') eq 'true' ? 1 : 0)
}
push @ret, $sf;
}
return \@ret;
}
sub _read_db_source {
my ($ann, $get) = @_;
my $dbsource = $get->('source-db');
# ripped mainly from Bio::SeqIO::genbank...
# deal with UniProKB dbsources
if( $dbsource =~
s/(UniProt(?:KB)?|swissprot):\s+locus\s+(\S+)\,[^.]+\.\s*// ) {
$ann->add_Annotation
('dblink',
Bio::Annotation::DBLink->new
(-primary_id => $2,
-database => $1,
-tagname => 'dblink'));
if( $dbsource =~ s/created:\s+([^.]+)\.\s*// ) {
$ann->add_Annotation
('swissprot_dates',
Bio::Annotation::SimpleValue->new
(-tagname => 'date_created',
-value => $1));
}
while( $dbsource =~
s/\s+(sequence|annotation)\s+
updated:\s+([^.]+)\.\s*//xg ) {
$ann->add_Annotation
('swissprot_dates',
Bio::Annotation::SimpleValue->new
(-tagname => 'date_updated',
-value => $2));
}
$dbsource =~ s/\n/ /g;
if ( $dbsource =~ s/xrefs:\s+
((?:\S+,\s+)+\S+)\s+xrefs/xrefs/x ) {
# will use $i to determine even or odd
# for swissprot the accessions are paired
my $i = 0;
for my $dbsrc ( split(/,\s+/,$1) ) {
if( $dbsrc =~ /(\S+)\.(\d+)/ ||
$dbsrc =~ /(\S+)/ ) {
my ($id,$version) = ($1,$2);
$version ='' unless defined $version;
my $db;
if( $id =~ /^\d\S{3}/) {
$db = 'PDB';
} else {
$db = ($i++ % 2 ) ? 'GenPept' : 'GenBank';
}
$ann->add_Annotation
('dblink',
Bio::Annotation::DBLink->new
(-primary_id => $id,
-version => $version,
-database => $db,
-tagname => 'dblink'));
}
}
}
elsif ( $dbsource =~ s/xrefs:\s+(.+)\s+xrefs/xrefs/i ) {
# download screwed up and ncbi didn't put
# acc in for gi numbers
my $i = 0;
for my $id ( split(/\,\s+/,$1) ) {
my ($acc,$db);
if( $id =~ /gi:\s+(\d+)/ ) {
$acc= $1;
$db = ($i++ % 2 ) ? 'GenPept' : 'GenBank';
} elsif( $id =~ /pdb\s+accession\s+(\S+)/ ) {
$acc= $1;
$db = 'PDB';
} else {
$acc= $id;
$db = '';
}
$ann->add_Annotation
('dblink',
Bio::Annotation::DBLink->new
(-primary_id => $acc,
-database => $db,
-tagname => 'dblink'));
}
} else {
warn "Cannot match $dbsource";
}
if( $dbsource =~ s/xrefs\s+\(non\-sequence\s+databases\):\s+
((?:\S+,\s+)+\S+)//x ) {
for my $id ( split(/\,\s+/,$1) ) {
my $db;
# quote from Bio::SeqIO::genbank:
# this is because GenBank dropped the spaces!!!
# I'm sure we're not going to get this right
$db = substr($id,0,index($id,':'));
$id = substr($id,index($id,':')+1);
$ann->add_Annotation
('dblink',
Bio::Annotation::DBLink->new
(-primary_id => $id,
-database => $db,
-tagname => 'dblink'));
}
}
}
else {
if( $dbsource =~ /^(\S*?):?\s*accession\s+(\S+)\.(\d+)/ ) {
my ($db,$id,$version) = ($1,$2,$3);
$ann->add_Annotation
('dblink',
Bio::Annotation::DBLink->new
(-primary_id => $id,
-version => $version,
-database => $db || 'GenBank',
-tagname => 'dblink'));
} elsif ( $dbsource =~ /(\S+)([\.:])(\d+)/ ) {
my ($id, $db, $version);
if ($2 eq ':') {
($db, $id) = ($1, $3);
} else {
($db, $id, $version) = ('GenBank', $1, $3);
}
$ann->add_Annotation('dblink',
Bio::Annotation::DBLink->new(
-primary_id => $id,
-version => $version,
-database => $db,
-tagname => 'dblink')
);
}
else {
warn "Unrecognized DBSOURCE data: $dbsource";
}
}
return 1;
}
1;
__END__
here\'s an example:
PROTEIN
0 HASH(0x439b8a8)
'GBSet' => HASH(0x439c010)
'GBSeq' => HASH(0x43a79c8)
'GBSeq_accession-version' => 'CAA53922.1'
'GBSeq_comment' => 'On Nov 8, 1997 this sequence version replaced gi:443947.'
'GBSeq_create-date' => '18-JAN-1994'
'GBSeq_definition' => 'sonic hedgehog [Mus musculus]'
'GBSeq_division' => 'ROD'
'GBSeq_feature-table' => HASH(0x43abf4c)
'GBFeature' => HASH(0x43b23b4)
'GBFeature_intervals' => HASH(0x43b800c)
'GBInterval' => HASH(0x43b83fc)
'GBInterval_accession' => 'CAA53922.1'
'GBInterval_from' => 1
'GBInterval_to' => 437
'GBFeature_key' => 'CDS'
'GBFeature_location' => '1..437'
'GBFeature_quals' => HASH(0x43b8378)
'GBQualifier' => HASH(0x43baeb0)
'GBQualifier_name' => 'db_xref'
'GBQualifier_value' => 'UniProtKB/Swiss-Prot:Q62226'
'GBSeq_length' => 437
'GBSeq_locus' => 'CAA53922'
'GBSeq_moltype' => 'AA'
'GBSeq_organism' => 'Mus musculus'
'GBSeq_other-seqids' => HASH(0x43ab028)
'GBSeqid' => 'gi|2597988'
'GBSeq_primary-accession' => 'CAA53922'
'GBSeq_references' => HASH(0x43abe80)
'GBReference' => HASH(0x43af1f8)
'GBReference_authors' => HASH(0x43af3e4)
'GBAuthor' => 'McMahon,A.P.'
'GBReference_journal' => 'Submitted (03-NOV-1997) A.P. McMahon, Harvard University, 16 Divinity Ave., Cambridge, MA 02138, USA'
'GBReference_position' => '1..437'
'GBReference_reference' => 3
'GBReference_title' => 'Direct Submission'
'GBSeq_sequence' => 'mllllarcflvilassllvcpglacgpgrgfgkrrhpkkltplaykqfipnvaektlgasgryegkitrnserfkeltpnynpdiifkdeentgadrlmtqrckdklnalaisvmnqwpgvklrvtegwdedghhseeslhyegravdittsdrdrskygmlarlaveagfdwvyyeskahihcsvkaensvaaksggcfpgsatvhleqggtklvkdlrpgdrvlaaddqgrllysdfltfldrdegakkvfyvietleprerllltaahllfvaphndsgptpgpsalfasrvrpgqrvyvvaerggdrrllpaavhsvtlreeeagayapltahgtilinrvlascyavieehswahrafapfrlahallaalapartdgggggsipaaqsateargaeptagihwysqllyhigtwlldsetmhplgmavkss'
'GBSeq_source' => 'Mus musculus (house mouse)'
'GBSeq_source-db' => 'embl accession X76290.1'
'GBSeq_taxonomy' => 'Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Sciurognathi; Muroidea; Muridae; Murinae; Mus'
'GBSeq_topology' => 'linear'
'GBSeq_update-date' => '04-NOV-1997'
NUCLEOTIDE
0 HASH(0x42c1a44)
'GBSet' => HASH(0x42dd728)
'GBSeq' => HASH(0x44bc2c8)
'GBSeq_accession-version' => 'NR_029721.1'
'GBSeq_comment' => 'PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AL645478.15.; ~Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq]; ~Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5\' and 3\' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage.'
'GBSeq_create-date' => '29-OCT-2009'
'GBSeq_definition' => 'Mus musculus microRNA 196a-1 (Mir196a-1), microRNA'
'GBSeq_division' => 'ROD'
'GBSeq_feature-table' => HASH(0x4579f0c)
'GBFeature' => HASH(0x457ab6c)
'GBFeature_intervals' => HASH(0x457fa20)
'GBInterval' => HASH(0x45813d0)
'GBInterval_accession' => 'NR_029721.1'
'GBInterval_from' => 24
'GBInterval_to' => 45
'GBFeature_key' => 'ncRNA'
'GBFeature_location' => '24..45'
'GBFeature_quals' => HASH(0x45813e8)
'GBQualifier' => HASH(0x4581a90)
'GBQualifier_name' => 'db_xref'
'GBQualifier_value' => 'MGI:2676860'
'GBSeq_length' => 102
'GBSeq_locus' => 'NR_029721'
'GBSeq_moltype' => 'ncRNA'
'GBSeq_organism' => 'Mus musculus'
'GBSeq_other-seqids' => HASH(0x456bea8)
'GBSeqid' => 'gi|262205520'
'GBSeq_primary' => 'REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP~1-102 AL645478.15 79764-79865 '
'GBSeq_primary-accession' => 'NR_029721'
'GBSeq_references' => HASH(0x45744ac)
'GBReference' => HASH(0x457ac20)
'GBReference_authors' => HASH(0x457f36c)
'GBAuthor' => 'Tuschl,T.'
'GBReference_journal' => 'RNA 9 (2), 175-179 (2003)'
'GBReference_position' => '1..102'
'GBReference_pubmed' => 12554859
'GBReference_reference' => 9
'GBReference_title' => 'New microRNAs from mouse and human'
'GBSeq_sequence' => 'tgagccgggactgttgagtgaagtaggtagtttcatgttgttgggcctggctttctgaacacaacgacatcaaaccacctgattcatggcagttactgcttc'
'GBSeq_source' => 'Mus musculus (house mouse)'
'GBSeq_strandedness' => 'single'
'GBSeq_taxonomy' => 'Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Sciurognathi; Muroidea; Muridae; Murinae; Mus'
'GBSeq_topology' => 'linear'
'GBSeq_update-date' => '06-JAN-2010'
|